PubMed Central (PMC3 - NLM DTD)
(2,081,148 recursos)
Archive of life sciences journal literature at the U.S. National Institutes of Health (NIH), developed and managed by NIH's National Center for Biotechnology Information (NCBI) in the National Library of Medicine (NLM).
Mostrando recursos 121 - 140 de 59,293
121.
Selective DNA amplification from complex genomes using universal double-sided adapters - Callow, Matthew J.; Drmanac, Snezana; Drmanac, Radoje
There is a rapidly developing need for new technologies to amplify millions of different targets from genomic DNA for high throughput genotyping and population gene-sequencing from diverse species. Here we describe a novel approach for the specific selection and amplification of genomic DNA fragments of interest that eliminates the need for costly and time consuming synthesis and testing of potentially millions of amplicon-specific primers. This technique relies upon Type IIs restriction enzyme digestion of genomic DNA and ligation of the fragments to double-sided adapters to form closed-circular DNA molecules. The novel use of double-sided adapters, assembled through the combinatorial use...
122.
Oligonucleotide-directed site-specific integration of high complexity libraries into ssDNA templates - Hale, M. B.; Nolan, G. P.; Wolkowicz, R.
We present an approach that generates an oligomer-based library with minimal need for restriction site modification of sequences in the target vector. The technique has the advantage that it can be applied for generating peptide aptamer libraries at sites within proteins without the need for introducing flanking enzyme sites. As an example we present a phagemid retroviral shuttle vector that can be used to achieve stable expression of the library in mammalian cells for the purpose of screening for peptides with desired biological activity.
123.
Mycobacterium tuberculosis Rv2118c codes for a single-component homotetrameric m1A58 tRNA methyltransferase - Varshney, U.; Ramesh, V.; Madabushi, A.; Gaur, R.; Subramanya, H. S.; RajBhandary, U. L.
Modified nucleosides in tRNAs play important roles in tRNA structure, biosynthesis and function, and serve as crucial determinants of bacterial growth and virulence. In the yeast Saccharomyces cerevisiae, mutants defective in N1-methylation of a highly conserved adenosine (A58) in the T?C loop of initiator tRNA are non-viable. The yeast m1A58 methyltransferase is a heterotetramer consisting of two different polypeptide chains, Gcd14p and Gcd10p. Interestingly, while m1A58 is not found in most eubacteria, the mycobacterial tRNAs have m1A58. Here, we report on the cloning, overexpression, purification and biochemical characterization of the Rv2118c gene-encoded protein (Rv2118p) from Mycobacterium tuberculosis, which is homologous...
124.
A gene-specific DNA sequencing chip for exploring molecular evolutionary change - Fedrigo, Olivier; Naylor, Gavin
Sequencing by hybridization (SBH) approaches to DNA sequencing face two conflicting constraints. First, in order to ensure that the target DNA binds reliably, the oligonucleotide probes that are attached to the chip array must be >15 bp in length. Secondly, the total number of possible 15 bp oligonucleotides is too large (>415) to fit on a chip with current technology. To circumvent the conflict between these two opposing constraints, we present a novel gene-specific DNA chip design. Our design is based on the idea that not all conceivable oligonucleotides need to be placed on a chip only those that capture...
125.
Biochemical characterization of the mitochondrial tRNASer(UCN) T7511C mutation associated with nonsyndromic deafness - Li, Xiaoming; Fischel-Ghodsian, Nathan; Schwartz, Faina; Yan, Qingfeng; Friedman, Rick A.; Guan, Min-Xin
We report here the biochemical characterization of the deafness-associated mitochondrial tRNASer(UCN) T7511C mutation, in conjunction with homoplasmic ND1 T3308C and tRNAAla T5655C mutations using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from an African family into human mtDNA-less (?°) cells. Three cybrids derived from an affected matrilineal relative carrying the homoplasmic T7511C mutation, exhibited ?75% decrease in the tRNASer(UCN) level, compared with three control cybrids. This amount of reduction in the tRNASer(UCN) level is below a proposed threshold to support a normal rate of mitochondrial protein synthesis in lymphoblastoid cell lines. This defect is likely a primary...
126.
Site-resolved stabilization of a DNA triple helix by magnesium ions - Coman, Daniel; Russu, Irina M.
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual WatsonCrick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the...
127.
Identification of a direct Dlx homeodomain target in the developing mouse forebrain and retina by optimization of chromatin immunoprecipitation - Zhou, Qing-Ping; Le, Trung Ngoc; Qiu, Xiangguo; Spencer, Virginia; de Melo, Jimmy; Du, Guoyan; Plews, Margot; Fonseca, Mario; Sun, Jian Min; Davie, James R.; Eisenstat, David D.
Understanding homeobox gene specificity and function has been hampered by the lack of proven direct transcriptional targets during development. Dlx genes are expressed in the developing forebrain, retina, craniofacial structures and limbs. Dlx1/Dlx2 double knockout mice die at birth with multiple defects including abnormal forebrain development and decreased Dlx5 and Dlx6 expression. We have successfully applied chromatin immunoprecipitation (ChIP) to identify a direct transcriptional target of DLX homeoproteins from embryonic tissues in vivo. We optimized cross-linking conditions to enrich for proteinDNA complexes, then using specific high affinity DLX antibodies captured immunoenriched DLX genomic DNA transcriptional targets. DLX homeobox proteins bind...
128.
Inhibitors of protein synthesis identified by a high throughput multiplexed translation screen - Novac, Olivia; Guenier, Anne-Sophie; Pelletier, Jerry
The use of small molecule inhibitors of cellular processes is a powerful approach to understanding gene function that complements the genetic approach. We have designed a high throughput screen to identify new inhibitors of eukaryotic protein synthesis. We used a bicistronic mRNA reporter to multiplex our assay and simultaneously screen for inhibitors of cap-dependent initiation, internal initiation and translation elongation/termination. Functional screening of >90 000 compounds in an in vitro translation reaction identified 36 inhibitors, 14 of which are known inhibitors of translation and 18 of which are nucleic acid-binding ligands. Our results indicate that intercalators constitute a large class...
129.
Assembly of the replication initiation complex on SV40 origin DNA - Simmons, Daniel T.; Gai, Dahai; Parsons, Rebekah; Debes, Amanda; Roy, Rupa
The assembly of the complex that forms over the simian virus 40 origin to initiate DNA replication is not well understood. This complex is composed of the virus-coded T antigen and three cellular proteins, replication protein A (RPA), DNA polymerase ?/primase (pol/prim) and topoisomerase I (topo I) in association with the origin. The order in which these various proteins bind to the DNA was investigated by performing binding assays using biotinylated origin DNA. We demonstrate that in the presence of all four proteins, pol/prim was essential to stabilize the initiation complex from the disruptive effects of topo I. At the...
130.
Pre-steady-state kinetics shows differences in processing of various DNA lesions by Escherichia coli formamidopyrimidine-DNA glycosylase - Koval, Vladimir V.; Kuznetsov, Nikita A.; Zharkov, Dmitry O.; Ishchenko, Alexander A.; Douglas, Kenneth T.; Nevinsky, Georgy A.; Fedorova, Olga S.
Formamidopyrimidine-DNA-glycosylase (Fpg pro tein, MutM) catalyses excision of 8-oxoguanine (8-oxoG) and other oxidatively damaged purines from DNA in a glycosylase/apurinic/apyrimidinic-lyase reaction. We report pre-steady-state kinetic analysis of Fpg action on oligonucleotide duplexes containing 8-oxo-2?-deoxyguanosine, natural abasic site or tetrahydrofuran (an uncleavable abasic site analogue). Monitoring Fpg intrinsic tryptophan fluorescence in stopped-flow experiments reveals multiple conformational transitions in the protein molecule during the catalytic cycle. At least four and five conformational transitions occur in Fpg during the interaction with abasic and 8-oxoG-containing substrates, respectively, within 2 ms to 10 s time range. These transitions reflect the stages of enzyme binding to...
131.
A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens - Hsieh, Andrew C.; Bo, Ronghai; Manola, Judith; Vazquez, Francisca; Bare, Olivia; Khvorova, Anastasia; Scaringe, Stephen; Sellers, William R.
Gene silencing through RNA interference (RNAi) has been established as a means of conducting reverse genetic studies. In order to better understand the determinants of short interfering RNA (siRNA) knockdown for use in high-throughput cell-based screens, 148 siRNA duplexes targeting 30 genes within the PI3K pathway were selected and synthesized. The extent of RNA knockdown was measured for 22 genes by quantitative real-time PCR. Analysis of the parameters correlating with effective knockdown showed that (i) duplexes targeting the middle of the coding sequence silenced significantly poorer, (ii) silencing by duplexes targeting the 3?UTR was comparable with duplexes targeting the coding...
132.
The effect of manganese(II) on DNA structure: electronic and vibrational circular dichroism studies - Polyanichko, A. M.; Andrushchenko, V. V.; Chikhirzhina, E. V.; Vorob'ev, V. I.; Wieser, H.
The interaction of DNA with Mn2+ was studied in absorbance and optical activity in the electronic and vibrational regions. Based on the data, several stages of the interaction were identified. Con formational transition towards the C-form of DNA was observed in solution at the molar ratio Mn2+/DNA-phosphates between 0.1 and 1.5. The exact ratio depended on the ionic strength and increased with increasing NaCl concentration. Although manganese interacted with the phosphates and bases of DNA at higher metal concentrations, it is unlikely that direct chelation occurred. A model for the interaction between manganese ions and DNA mediated by water is...
133.
Statistical analysis of over-represented words in human promoter sequences - Mariño-Ramírez, Leonardo; Spouge, John L.; Kanga, Gavin C.; Landsman, David
The identification and characterization of regulatory sequence elements in the proximal promoter region of a gene can be facilitated by knowing the precise location of the transcriptional start site (TSS). Using known TSSs from over 5700 different human full-length cDNAs, this study extracted a set of 4737 distinct putative promoter regions (PPRs) from the human genome. Each PPR consisted of nucleotides from 2000 to +1000 bp, relative to the corresponding TSS. Since many regulatory regions contain short, highly conserved strings of less than 10 nucleotides, we counted eight-letter words within the PPRs, using z-scores and other related statistics to evaluate...
134.
Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference - Ui-Tei, Kumiko; Naito, Yuki; Takahashi, Fumitaka; Haraguchi, Takeshi; Ohki-Hamazaki, Hiroko; Juni, Aya; Ueda, Ryu; Saigo, Kaoru
In the present study, the relationship between short interfering RNA (siRNA) sequence and RNA interference (RNAi) effect was extensively analyzed using 62 targets of four exogenous and two endogenous genes and three mammalian and Drosophila cells. We present the rules that may govern siRNA sequence preference and in accordance with which highly effective siRNAs essential for systematic mammalian functional genomics can be readily designed. These rules indicate that siRNAs which simultaneously satisfy all four of the following sequence conditions are capable of inducing highly effective gene silencing in mammalian cells: (i) A/U at the 5? end of the antisense strand;...
135.
Kinetic and thermodynamic characterization of the RNA-cleaving 8-17 deoxyribozyme - Bonaccio, Maria; Credali, Alfredo; Peracchi, Alessio
The 8-17 deoxyribozyme is a small DNA catalyst of significant applicative interest. We have analyzed the kinetic features of a well behaved 8-17 construct and determined the influence of several reaction conditions on such features, providing a basis for further exploration of the deoxyribozyme mechanism. The 8-17 bound its substrate with a rate constant ?10-fold lower than those typical for the annealing of short complementary oligonucleotides. The observed free energy of substrate binding indicates that an energetic penalty near to +7 kcal/mol is attributable to the deoxyribozyme core. Substrate cleavage required divalent metal ion cofactors, and the dependence of activity...
136.
The importance of intrinsic disorder for protein phosphorylation - Iakoucheva, Lilia M.; Radivojac, Predrag; Brown, Celeste J.; O'Connor, Timothy R.; Sikes, Jason G.; Obradovic, Zoran; Dunker, A. Keith
Reversible protein phosphorylation provides a major regulatory mechanism in eukaryotic cells. Due to the high variability of amino acid residues flanking a relatively limited number of experimentally identified phosphorylation sites, reliable prediction of such sites still remains an important issue. Here we report the development of a new web-based tool for the prediction of protein phosphorylation sites, DISPHOS (DISorder-enhanced PHOSphorylation predictor, http://www.ist.temple.edu/DISPHOS). We observed that amino acid compositions, sequence complexity, hydrophobicity, charge and other sequence attributes of regions adjacent to phosphorylation sites are very similar to those of intrinsically disordered protein regions. Thus, DISPHOS uses position-specific amino acid frequencies and...
137.
Protein interaction mapping on a functional shotgun sequence of Rickettsia sibirica - Malek, Joel A.; Wierzbowski, Jamey M.; Tao, Wei; Bosak, Stephanie A.; Saranga, David J.; Doucette-Stamm, Lynn; Smith, Douglas R.; McEwan, Paul J.; McKernan, Kevin J.
Protein interaction maps can reveal novel pathways and functional complexes, allowing guilt by association annotation of uncharacterized proteins. To address the need for large-scale protein interaction analyses, a bacterial two-hybrid system was coupled with a whole genome shotgun sequencing approach for microbial genome analysis. We report the first large-scale proteomics study using this system, integrating de novo genome sequencing with functional interaction mapping and annotation in a high-throughput format. We apply the approach by shotgun sequencing and annotating the genome of Rickettsia sibirica strain 246, an obligate intracellular human pathogen among the Spotted Fever Group rickettsiae. The bacteria invade endothelial...
138.
Biased distribution of DNA uptake sequences towards genome maintenance genes - Davidsen, Tonje; Rødland, Einar A.; Lagesen, Karin; Seeberg, Erling; Rognes, Torbjørn; Tønjum, Tone
Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 910mers residing within coding regions are the DNA uptake sequences (DUS) required for natural genetic transformation. More importantly, we found a significantly higher density of DUS within genes involved in DNA repair, recombination, restriction-modification and replication than in any other annotated gene group in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified...
139.
The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1 - Rasko, David A.; Ravel, Jacques; Økstad, Ole Andreas; Helgason, Erlendur; Cer, Regina Z.; Jiang, Lingxia; Shores, Kelly A.; Fouts, Derrick E.; Tourasse, Nicolas J.; Angiuoli, Samuel V.; Kolonay, James; Nelson, William C.; Kolstø, Anne-Brit; Fraser, Claire M.; Read, Timothy D.
We sequenced the complete genome of Bacillus cereus ATCC 10987, a non-lethal dairy isolate in the same genetic subgroup as Bacillus anthracis. Comparison of the chromosomes demonstrated that B.cereus ATCC 10987 was more similar to B.anthracis Ames than B.cereus ATCC 14579, while containing a number of unique metabolic capabilities such as urease and xylose utilization and lacking the ability to utilize nitrate and nitrite. Additionally, genetic mechanisms for variation of capsule carbohydrate and flagella surface structures were identified. Bacillus cereus ATCC 10987 contains a single large plasmid (pBc10987), of ?208 kb, that is similar in gene content and organization to...
140.
Physical and functional interaction of the archaeal single-stranded DNA-binding protein SSB with RNA polymerase - Richard, Derek J.; Bell, Stephen D.; White, Malcolm F.
Archaeal transcription utilizes a complex multisubunit RNA polymerase and the basal transcription factors TBP and TF(II)B, closely resembling its eukaryal counterpart. We have uncovered a tight physical and functional interaction between RNA polymerase and the single-stranded DNA-binding protein SSB in Sulfolobus solfataricus. SSB stimulates transcription from promoters in vitro under TBP-limiting conditions and supports transcription in the absence of TBP. SSB also rescues transcription from repression by reconstituted chromatin. We demonstrate the potential for promoter melting by SSB, suggesting a plausible basis for the stimulation of transcription. This stimulation requires both the single-stranded DNA-binding domain and the acidic C-terminal tail...
121.
