Sunday, December 14, 2014

 

 



Soy un nuevo usuario

Olvidé mi contraseña

Entrada usuarios

Lógica Matemáticas Astronomía y Astrofísica Física Química Ciencias de la Vida
Ciencias de la Tierra y Espacio Ciencias Agrarias Ciencias Médicas Ciencias Tecnológicas Antropología Demografía
Ciencias Económicas Geografía Historia Ciencias Jurídicas y Derecho Lingüística Pedagogía
Ciencia Política Psicología Artes y Letras Sociología Ética Filosofía
 

rss_1.0 Recursos de colección

SciELO Brasil - Scientific Electronic Library Online (76,924 recursos)
SciELO (Scientific Electronic Library Online) is an electronic library covering a selected collection of Brazilian scientific journals. The objective of the site is to implement an electronic virtual library, providing full access to a collection of serial titles, a collection of issues from individual serial titles, as well as to the full text of articles. The project envisages the development of a common methodology for the preparation, storage, dissemination and evaluation of scientific literature in electronic format.

Revista de Microbiologia (97) Anais da Academia Brasileira de Ciências (881)
Arquivos Brasileiros de Endocrinologia & Metabologia (586) Arquivos Brasileiros de Oftalmologia (687)
Arquivos de Gastroenterologia (349) Arquivos de Neuro-Psiquiatria (1,814)
Bragantia (409) Dados - Revista de Ciências Sociais (199)
Jornal de Pediatria (479) Papéis Avulsos de Zoologia (São Paulo) (32)
Revista Brasileira de Anestesiologia (645) Revista Brasileira de Biologia (236)
Revista Brasileira de Economia (125) Revista Brasileira de Otorrinolaringologia (431)
Revista de Antropologia (181) Revista de Saúde Pública (2,317)
Revista do Instituto de Medicina Tropical de São Paulo (981) Revista da Sociedade Brasileira de Medicina Tropical (1,213)
Revista do Hospital das Clínicas (288) Acta Amazonica (350)
Arquivos Brasileiros de Cardiologia (1,525) Iheringia. Série Zoologia (213)
Memórias do Instituto Oswaldo Cruz (2,048) Revista Brasileira de Entomologia (268)
Revista Brasileira de Ciência do Solo (421) Cadernos de Pesquisa (160)
Ciência da Informação (349) Pesquisa Agropecuária Brasileira (1,322)
Revista Brasileira de Fruticultura (817) Radiologia Brasileira (626)
Química Nova (1,608) Fitopatologia Brasileira (509)
Eclética Química (201) Revista Árvore (393)
Revista Brasileira de Ginecologia e Obstetrícia (739) Pesquisa Veterinária Brasileira (405)
Journal of the Brazilian Society of Mechanical Sciences (165) Planta Daninha (405)
Revista Brasileira de Botânica (431) Brazilian Journal of Genetics (112)
Brazilian Journal of Medical and Biological Research (2,454) Ciência e Tecnologia de Alimentos (861)
Revista Brasileira de Sementes (135) Cadernos CEDES (197)
Estudos Afro-Asiáticos (68) Revista de Psiquiatria Clínica (108)
Educação & Sociedade (545) Pesquisa Operacional (178)
Revista de Psiquiatria do Rio Grande do Sul (92) Revista Brasileira de Zoologia (257)
Computational & Applied Mathematics (26) Revista Brasileira de História (229)
Horticultura Brasileira (513) Arquivo Brasileiro de Medicina Veterinária e Zootecnia (923)
Revista da Faculdade de Educação (45) Revista Brasileira de Geofísica (308)
Cadernos de Saúde Pública (3,029) Acta Botanica Brasilica (375)
Jornal de Pneumologia (311) Psicologia: Teoria e Pesquisa (290)
DELTA: Documentação de Estudos em Lingüística Teórica e Aplicada (280) Revista Brasileira de Ensino de Física (214)
Lua Nova: Revista de Cultura e Política (91) Revista Brasileira de Ciências Sociais (369)
Psicologia & Sociedade (176) Revista Brasileira de Cirurgia Cardiovascular (470)
Psicologia: Reflexão e Crítica (436) Acta Cirurgica Brasileira (1,137)
São Paulo em Perspectiva (285) Revista de Odontologia da Universidade de São Paulo (177)
Sba: Controle & Automação Sociedade Brasileira de Automatica (177) Revista de Economia e Sociologia Rural (75)
Revista Brasileira de Fisiologia Vegetal (48) Estudos Avançados (550)
Journal of the Brazilian Chemical Society (1,034) Brazilian Dental Journal (157)
Psicologia USP (303) Ciência Rural (2,173)
Scientia Agricola (1,201) Brazilian Journal of Physics (1,135)
Revista Estudos Feministas (298) Revista Latino-Americana de Enfermagem (724)
Polímeros - Ciência e Tecnologia (405) Revista da Associação Médica Brasileira (1,031)
Revista de Sociologia e Política (170) Gestão & Produção (183)
História, Ciências, Saúde-Manguinhos (540) Opinião Pública (99)
Journal of the Brazilian Computer Society (104) Brazilian Journal of Chemical Engineering (601)
Horizontes Antropológicos (169) Journal of Venomous Animals and Toxins (253)
Mana - Estudos de Antropologia Social (241) Anais Brasileiros de Dermatologia (472)
Cerâmica (412) Rem: Revista Escola de Minas (306)
Estudos de Psicologia (Natal) (277) Psicologia em Estudo (239)
Acta Ortopédica Brasileira (124) Ciência & Saúde Coletiva (1,499)
Brazilian Journal of Infectious Diseases (398) Brazilian Journal of Veterinary Research and Animal Science (389)
Ambiente & sociedade (101) Revista Brasileira de Engenharia Agrícola e Ambiental (604)
Genetics and Molecular Biology (797) Revista de Nutrição (317)
Materials Research (629) Sao Paulo Medical Journal (471)
Revista Brasileira de Zootecnia (1,800) Revista Brasileira de Psiquiatria (742)
Revista Brasileira de Ciência Avícola (208) Revista Brasileira de Hematologia e Hemoterapia (314)
Brazilian Archives of Biology and Technology (631) Alea : Estudos Neolatinos (103)
Sociologias (256) Pesquisa Odontológica Brasileira (260)
Brazilian Journal of Microbiology (663) Revista Brasileira de Medicina do Esporte (188)
Educação e Pesquisa (242) Revista Brasileira de Saúde Materno Infantil (224)
Neotropical Entomology (668) Brazilian Journal of Biology (525)
Jornal Brasileiro de Patologia e Medicina Laboratorial (273) Brazilian Journal of Plant Physiology (71)
International braz j urol (472) Journal of the Brazilian Society of Mechanical Sciences and Engineering (193)
Journal of Applied Oral Science (316) Journal of Venomous Animals and Toxins including Tropical Diseases (178)
Brazilian Journal of Cardiovascular Surgery (67) Jornal Brasileiro de Pneumologia (301)
Brazilian Oral Research (277) Engenharia Agrícola (195)
Clinics (230) Revista Brasileira de Epidemiologia (231)
Cadernos Pagu (142) Revista de Economia Política (87)
Revista de Administra��o Contempor�nea (296) RAE eletrônica (29)
Interações (Campo Grande) (59) Revista Dental Press de Ortodontia e Ortopedia Facial (12)
Revista de Administração de Empresas (115) Revista Brasileira de Enfermagem (171)
Revista Brasileira de Oftalmologia (67) Revista de Administração Pública (113)
Revista da Escola de Enfermagem da USP (231) Kriterion: Revista de Filosofia (88)
Summa Phytopathologica (68) Revista Brasileira de Educação Médica (76)
Revista do Colégio Brasileiro de Cirurgiões (104) Jornal Brasileiro de Nefrologia (105)
Estudos Econômicos (São Paulo) (43) Anais do Museu Paulista: História e Cultura Material (17)
Serviço Social & Sociedade (78) Revista Brasileira de Coloproctologia (58)
Revista Brasileira de Estudos de População (49) Revista Brasileira de Ortopedia (68)
ABCD. Arquivos Brasileiros de Cirurgia Digestiva (São Paulo) (109) Revista Brasileira de Meteorologia (49)
Contexto Internacional (7) Revista Paulista de Pediatria (104)
Estudos de Psicologia (Campinas) (52) Trabalhos em Linguística Aplicada (42)
Tempo Social (25) Acta Paulista de Enfermagem (106)
Estudos Históricos (Rio de Janeiro) (38) Revista Brasileira de Terapia Intensiva (66)
Fisioterapia em Movimento (Impresso) (87) Psicologia Clínica (18)
Texto & Contexto - Enfermagem (110) Saúde e Sociedade (146)
Ensaio: Avaliação e Políticas Públicas em Educação (57) Pró-Fono Revista de Atualização Científica (83)
Varia Historia (35) Soldagem & Inspeção (Impresso) (56)
Revista Brasileira de Reumatologia (163) Revista Brasileira de Fisioterapia (81)
Engenharia Sanitaria e Ambiental (68) Ciência e Agrotecnologia (239)
Tempo (39) Economia Aplicada (22)
Psicologia Escolar e Educacional (Impresso) (41) Interface - Comunicação, Saúde, Educação (154)
Revista Katálysis (57) Escola Anna Nery (159)
Revista Latinoamericana de Psicopatologia Fundamental (70) Revista Brasileira de Plantas Medicinais (69)
Ágora: Estudos em Teoria Psicanalítica (44) Revista CEFAC (211)
Biota Neotropica (126) Jornal Vascular Brasileiro (66)
Scientiae Studia (21) RAM. Revista de Administração Mackenzie (Online) (56)
Cadernos EBAPE.BR (50) Brazilian Journal of Oceanography (64)
Revista Brasileira de Ensino de Física (72) Revista Ciência Agronômica (390)
Computational & Applied Mathematics (21) BAR. Brazilian Administration Review (90)
Coluna/Columna (70) Revista Direito GV (31)
Brazilian Journal of Otorhinolaryngology (Impresso) (174) Tropical Plant Pathology (49)
Revista Gaúcha de Enfermagem (Online) (78) Psychology & Neuroscience (Online) (32)
Revista Brasileira de Parasitologia Veterinária (Online) (82) Zoologia (Curitiba, Impresso) (101)
Brazilian Journal of Pharmaceutical Sciences (114) Dental Press Journal of Orthodontics (129)
Acta Limnologica Brasiliensia (Online) (24) Revista Brasileira de Política Internacional (23)
Religião & Sociedade (12) Novos Estudos - CEBRAP (41)
Revista Brasileira de Farmacognosia (439) Avaliação: Revista da Avaliação da Educação Superior (Campinas) (47)
Educação em Revista (64) Sociedade e Estado (47)
Caderno CRH (46) Nova Economia (10)
Pro-Posições (66) Paidéia (Ribeirão Preto) (47)
Economia e Sociedade (27) Revista Brasileira de Educação (47)
Revista Brasileira de Educação Especial (36) Psico-USF (Impresso) (30)
Perspectivas em Ciência da Informação (29) Revista de Economia Contemporânea (15)
Linguagem em (Dis)curso (Impresso) (31) Revista Contabilidade & Finanças (19)
Boletim do Museu Paraense Emílio Goeldi. Ciências Humanas (47) Sociedade & Natureza (Online) (58)
Fractal : Revista de Psicologia (50) Revista Brasileira de Ciências do Esporte (Impresso) (17)
Produção (93) Psicologia: Ciência e Profissão (48)
Journal of Epilepsy and Clinical Neurophysiology (8) Revista Brasileira de Educação Física e Esporte (Impresso) (40)
Acta Scientiarum. Agronomy (Online) (225) Arquivos Internacionais de Otorrinolaringologia (Impresso) (135)
Motriz: Revista de Educação Física (Online) (101) Revista Brasileira de Cirurgia Plástica (Impresso) (99)
Crop Breeding and Applied Biotechnology (Online) (45) Trabalho, Educação e Saúde (Online) (120)
História (São Paulo) (19) Physis: Revista de Saúde Coletiva (38)
Educar em Revista (42) Revista da Sociedade Brasileira de Fonoaudiologia (75)
Per Musi (115) Ambiente Construído (Online) (43)
Jornal Brasileiro de Psiquiatria (26) Trans/Form/Ação - Revista de Filosofia (18)
Ciência & Educação (Bauru) (30) Matéria (Rio de Janeiro) (10)
Neotropical Ichthyology (46) Latin American Journal of Solids and Structures (Online) (135)
JISTEM - Journal of Information Systems and Technology Management (Online) (12) Revista Brasileira de Linguística Aplicada (43)
Revista Ceres (Impresso) (40) Jornal da Sociedade Brasileira de Fonoaudiologia (18)
Revista Brasileira de Cineantropometria & Desempenho Humano (Online) (48) Acta Scientiarum. Animal Sciences (45)
Internationl Archives of Othorinolaryngology (37) Revista Brasileira de Ciência Política (44)
Brazilian Journal of Food Technology (10) História da Educação (26)
Transinformação (17) urbe. Revista Brasileira de Gestão Urbana (22)
Journal of Transport Literature (27) Alfa : Revista de Linguística (São José do Rio Preto) (10)
Educação & Realidade (17) Revista Ambiente & Água (16)
Organizações & Sociedade (10)


Mostrando recursos 1 - 20 de 150

1. A morphometric study of the lumbar spinous process in the Chinese population - Cai,B.; Ran,B.; Li,Q.; Li,Z.H.; Li,F.N.; Li,M.; Yan,W.J.
Our goal was to analyze the anatomical parameters of the lumbar spine spinous process for an interspinous stabilization device designed for the Chinese population and to offer an anatomical basis for its clinical application. The posterior lumbar spines (T12-S1) of 52 adult cadavers were used for measuring the following: distance between two adjacent spinous processes (DB), distance across two adjacent spinous processes (DA), thickness of the central spinous processes (TC), thickness of the superior margin of the spinous processes (TS), thickness of the inferior margin of the spinous processes (TI), and height of the spinous processes (H). Variance and correlation...

2. Effect of salt intake and potassium supplementation on brachial-ankle pulse wave velocity in Chinese subjects: an interventional study - Wang,Y.; Mu,J.J.; Geng,L.K.; Wang,D.; Ren,K.Y.; Guo,T.S.; Chu,C.; Xie,B.Q.; Liu,F.Q.; Yuan,Z.Y.
Accumulating evidence has suggested that high salt and potassium might be associated with vascular function. The aim of this study was to investigate the effect of salt intake and potassium supplementation on brachial-ankle pulse wave velocity (PWV) in Chinese subjects. Forty-nine subjects (28-65 years of age) were selected from a rural community of northern China. All subjects were sequentially maintained on a low-salt diet for 7 days (3.0 g/day NaCl), a high-salt diet for an additional 7 days (18.0 g/day NaCl), and a high-salt diet with potassium supplementation for a final 7 days (18.0 g/day NaCl+4.5 g/day KCl). Brachial-ankle PWV...

3. Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus - Cai,X.Z.; Huang,W.Y.; Qiao,Y.; Chen,Y.; Du,S.Y.; Chen,D.; Yu,S.; Liu,N.; Dou,L.Y.; Jiang,Y.
The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls...

4. Combined aliskiren and L-arginine treatment has antihypertensive effects and prevents vascular endothelial dysfunction in a model of renovascular hypertension - Santuzzi,C.H.; Tiradentes,R.V.; Mengal,V.; Claudio,E.R.G.; Mauad,H.; Gouvea,S.A.; Abreu,G.R.
Angiotensin II is a key player in the pathogenesis of renovascular hypertension, a condition associated with endothelial dysfunction. We investigated aliskiren (ALSK) and L-arginine treatment both alone and in combination on blood pressure (BP), and vascular reactivity in aortic rings. Hypertension was induced in 40 male Wistar rats by clipping the left renal artery. Animals were divided into Sham, 2-kidney, 1-clip (2K1C) hypertension, 2K1C+ALSK (ALSK), 2K1C+L-arginine (L-arg), and 2K1C+ALSK+L-arginine (ALSK+L-arg) treatment groups. For 4 weeks, BP was monitored and endothelium-dependent and independent vasoconstriction and relaxation were assessed in aortic rings. ALSK+L-arg reduced BP and the contractile response to phenylephrine and...

5. Antidepressant-like effect of Hoodia gordonii in a forced swimming test in mice: evidence for involvement of the monoaminergic system - Citó,M.C.O.; Silva,M.I.G.; Santos,L.K.X.; Fernandes,M.L.; Melo,F.H.C.; Aguiar,J.A.C.; Lopes,I.S.; Sousa,P.B.; Vasconcelos,S.M.M.; Macêdo,D.S.; Sousa,F.C.F.
Hoodia gordonii is a plant species used traditionally in southern Africa to suppress appetite. Recently, it has been associated with a significant increase in blood pressure and pulse rate in women, suggesting sympathomimetic activity. The present study investigated the possible antidepressant-like effects of acute and repeated (15 days) administration of H. gordonii extract (25 and 50 mg/kg, po) to mice exposed to a forced swimming test (FST). Neurochemical analysis of brain monoamines was also carried out to determine the involvement of the monoaminergic system on these effects. Acute administration of H. gordonii decreased the immobility of mice in the FST...

6. Resveratrol inhibits the intracellular calcium increase and angiotensin/endothelin system activation induced by soluble uric acid in mesangial cells - Albertoni,G.; Schor,N.
Resveratrol (Resv) is natural polyphenol found in grapes. This study evaluated the protective effect of Resv against the effects of uric acid (UA) in immortalized human mesangial cells (ihMCs). ihMCs were preincubated with Resv (12.5 µM) for 1 h and treated with UA (10 mg/dL) for 6 or 12 h. The intracellular calcium concentration [Ca2+]i was quantified by fluorescence using flow cytometry. Angiotensinogen (AGT) and pre-pro endothelin-1 (ppET-1) mRNA were assayed by quantitative real-time RT-PCR. Angiotensin II (AII) and endothelin-1 (ET-1) were assayed by ELISA. UA significantly increased [Ca2+]i. Pre-incubation with Resv significantly reduced the change in [Ca2+]i induced by...

7. Analysis of heart rate control to assess thermal sensitivity responses in Brazilian toads - Natali,J.E.S.; Santos,B.T.; Rodrigues,V.H.; Chauí-Berlinck,J.G.
In anurans, changes in ambient temperature influence body temperature and, therefore, energy consumption. These changes ultimately affect energy supply and, consequently, heart rate (HR). Typically, anurans living in different thermal environments have different thermal sensitivities, and these cannot be distinguished by changes in HR. We hypothesized that Rhinella jimi (a toad from a xeric environment that lives in a wide range of temperatures) would have a lower thermal sensitivity regarding cardiac control than R. icterica (originally from a tropical forest environment with a more restricted range of ambient temperatures). Thermal sensitivity was assessed by comparing animals housed at 15° and...

8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response - Dang,N.N.; Pang,S.G.; Song,H.Y.; An,L.G.; Ma,X.L.
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13,...

9. More than 10 years survival with sequential therapy in a patient with advanced renal cell carcinoma: a case report - Yuan,J.L.; Wang,F.L.; Yi,X.M.; Qin,W.J.; Wu,G.J.; Huan,Y.; Yang,L.J.; Zhang,G.; Yu,L.; Zhang,Y.T.; Qin,R.L.; Tian,C.J.
Although radical nephrectomy alone is widely accepted as the standard of care in localized treatment for renal cell carcinoma (RCC), it is not sufficient for the treatment of metastatic RCC (mRCC), which invariably leads to an unfavorable outcome despite the use of multiple therapies. Currently, sequential targeted agents are recommended for the management of mRCC, but the optimal drug sequence is still debated. This case was a 57-year-old man with clear-cell mRCC who received multiple therapies following his first operation in 2003 and has survived for over 10 years with a satisfactory quality of life. The treatments given included several...

10. Practices and ethical concerns regarding preimplantation diagnosis. Who regulates preimplantation genetic diagnosis in Brazil? - Damian,B.B.; Bonetti,T.C.S.; Horovitz,D.D.G.
Preimplantation genetic diagnosis (PGD) was originally developed to diagnose embryo-related genetic abnormalities for couples who present a high risk of a specific inherited disorder. Because this technology involves embryo selection, the medical, bioethical, and legal implications of the technique have been debated, particularly when it is used to select features that are not related to serious diseases. Although several initiatives have attempted to achieve regulatory harmonization, the diversity of healthcare services available and the presence of cultural differences have hampered attempts to achieve this goal. Thus, in different countries, the provision of PGD and regulatory frameworks reflect the perceptions of...

11. Intensive chemotherapy as salvage treatment for solid tumors: focus on germ cell cancer - Selle,F.; Gligorov,J.; Richard,S.; Khalil,A.; Alexandre,I.; Avenin,D.; Provent,S.; Soares,D.G.; Lotz,J.P.
Germ cell tumors present contrasting biological and molecular features compared to many solid tumors, which may partially explain their unusual sensitivity to chemotherapy. Reduced DNA repair capacity and enhanced induction of apoptosis appear to be key factors in the sensitivity of germ cell tumors to cisplatin. Despite substantial cure rates, some patients relapse and subsequently die of their disease. Intensive doses of chemotherapy are used to counter mechanisms of drug resistance. So far, high-dose chemotherapy with hematopoietic stem cell support for solid tumors is used only in the setting of testicular germ cell tumors. In that indication, high-dose chemotherapy is...

12. Rosai-Dorfman disease: a report of eight cases in a tertiary care center and a review of the literature - Maia,R.C.; de Meis,E.; Romano,S.; Dobbin,J.A.; Klumb,C.E.
Rosai-Dorfman disease (RDD) is a nonmalignant histiocytic disorder of unknown origin that is extremely rare. By immunohistochemistry, the RDD cells are characteristically S-100 positive and CD1a negative. Emperipolesis is a common histopathological finding, although not specific for RDD. Lymph node and cutaneous manifestations are most frequent, but diverse organs can be affected. The clinical course is unpredictable regardless of treatment. Here, we present a series of 8 cases presenting lymph node and/or cutaneous lesions. Lymph node involvement was seen in diverse regions, including mediastinal and retroperitoneal. The treatment response to steroids was diversified, and the chemotherapy response was disappointing. Associated...

13. Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C2H2 zinc finger protein - Han,D.; Zhang,C.; Fan,W.J.; Pan,W.J.; Feng,D.M.; Qu,S.L.; Jiang,Z.S.
Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic...

14. Vigilância em Saúde do Trabalhador: avanços e perspectivas - Minayo,Maria Cecília de Souza; Gualhano,Luiza

15. Discarded bycatch survival can impact the species populations?

16. Para que [e a quem] servem instrumentos de seleção como o vestibular e o Enem?

17. CLINICAL MANIFESTATIONS SEEMED MORE SEVERE AMONG PATIENTS WITH ANTIBODY 4-FOLD OR A GREATER INCREASE IN TITER BOTH AGAINST pH1N1 AND AGAINST SEASONAL INFLUENZA THAN THOSE WHOSE ANTIBODY 4-FOLD OR GREATER INCREASE IN TITER WAS ONLY AGAINST ONE TYPE OF SEASONAL INFLUENZA - Li,Tiegang; Wang,Ming

18. SPECIES COMPOSITION OF CARRION BLOW FLIES IN NORTHERN THAILAND: ALTITUDE APPRAISAL - Moophayak,Kittikhun; Klong-Klaew,Tunwadee; Sukontason,Kom; Kurahashi,Hiromu; Tomberlin,Jeffery K.; Sukontason,Kabkaew L.
Distribution and occurrence of blow flies of forensic importance was performed during 2007 and 2008 in Chiang Mai and Lampang Provinces, northern Thailand. Surveys were conducted in forested areas for 30 minutes using a sweep net to collected flies attracted to a bait. A total of 2,115 blow flies belonging to six genera and 14 species were collected; Chrysomya megacephala (Fabricius) (44.7%), C. pinguis (Walker) (15.1%), C. chani Kurahashi (9.3%), C. thanomthini Kurahashi & Tumrasvin (0.3%); Achoetandrus rufifacies (Macquart) (10.5%), A. villeneuvi (Patton) (2.2%); Lucilia papuensis Macquart (2.2%), L. porphyrina (Walker) (12.4%), L. sinensis Aubertin (0.7%); Hemipyrellia ligurriens (Wiedemann) (1.3%),...

19. TWO NEW RECORDS OF Isomyia paurogonita FANG AND FAN, 1986 AND Sumatria latifrons Malloch, 1926 (DIPTERA: CALLIPHORIDAE) FROM NORTHERN THAILAND, WITH REVISED KEY TO THE SPECIES OF Isomyia - Bunchu,Nophawan; Moophayak,Kittikhun; Sanit,Sangob; Sukontason,Kabkaew L.; Sukontason,Kom; Kurahashi,Hiromu
During the annual fly survey at Doi Nang Kaew in Doi Saket District, Chiang Mai Province of Thailand in 2011, Isomyia paurogonita Fang & Fan, 1986 (Diptera: Calliphoridae) and Sumatria latifrons Malloch, 1926 (Diptera: Calliphoridae) were collected for the first time in Thailand. They are the rare species of the subfamily Rhiniinae (tribe Cosminini). Prior to this finding, fifteen species of Isomyia and two species of Sumatria were recorded from Thailand. Therefore, 96 blow fly species have been found in this country. These new locality records of both flies are very important for further research on their biology and ecology...

20. SEROPREVALENCE OF T. cruzi INFECTION IN BLOOD DONORS AND CHAGAS CARDIOMYOPATHY IN PATIENTS FROM THE COAL MINING REGION OF COAHUILA, MEXICO - Martinez-Tovar,Jose Gerardo; Rebollar-Tellez,Eduardo A.; Salas,Ildefonso Fernandez
Context and Objective: Chagas disease is considered a worldwide emerging disease; it is endemic in Mexico and the state of Coahuila and is considered of little relevance. The objective of this study was to determine the seroprevalence of T. cruzi infection in blood donors and Chagas cardiomyopathy in patients from the coal mining region of Coahuila, Mexico. Design and Setting: Epidemiological, exploratory and prospective study in a general hospital during the period January to June 2011. Methods: We performed laboratory tests ELISA and indirect hemagglutination in three groups of individuals: 1) asymptomatic voluntary blood donors, 2) patients hospitalized in the...

Página de resultados:
 

Busque un recurso